View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359-Insertion-8 (Length: 169)
Name: NF0359-Insertion-8
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359-Insertion-8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 1e-42; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 7 - 102
Target Start/End: Original strand, 1102272 - 1102367
Alignment:
| Q |
7 |
aatattgtctcataatgatttactcgatttttataaaactcaatgcaaaagctgaatgttaagatttcttgtttgtgaaaattgtacttgtgagtg |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1102272 |
aatattgtctcataatgatttattcgatttttataaaactcaatgcaaaagctgaatgttaagatttcttgtttgtgaaaattgtagttgtgagtg |
1102367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 84 - 166
Target Start/End: Original strand, 1105098 - 1105179
Alignment:
| Q |
84 |
aaaattgtacttgtgagtgatatgtcaattattttgtccatcaattattatcttgttctgtttattctgtccatctacaaatc |
166 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1105098 |
aaaattatagttgtgagtgatatgtcaattattt-gtccatcaattattatcctgttctgcttattctgtccatctacaaatc |
1105179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 6e-20
Query Start/End: Original strand, 27 - 92
Target Start/End: Original strand, 1103786 - 1103851
Alignment:
| Q |
27 |
tactcgatttttataaaactcaatgcaaaagctgaatgttaagatttcttgtttgtgaaaattgta |
92 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
1103786 |
tactcgatttttataaaacttaatacaaaagctgaatgtttagatttgttgtttgtgaaaattgta |
1103851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 76
Target Start/End: Original strand, 80763 - 80821
Alignment:
| Q |
20 |
aatgatttactcgatttttataaaactcaa--tgcaaaagctgaatgttaagatttctt |
76 |
Q |
| |
|
|||||||||| | |||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
80763 |
aatgatttacatgttttttataaaactcaaaatgcaaaagctgaatgttaaggtttctt |
80821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University