View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359-Insertion-9 (Length: 151)
Name: NF0359-Insertion-9
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359-Insertion-9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 151
Target Start/End: Original strand, 9439126 - 9439270
Alignment:
| Q |
8 |
atatgaagttgactgttt-ggaattaactgcaagatataatttctaacgatgggaggtatgatgtccttgcacagcctgacaataggtgcaatgacatga |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9439126 |
atatgaagttgactgttttggaattaactgcaagatataatttctaacgatgggaggtatgatgcccttgcacaacctgacaataggtgcaatgacatga |
9439225 |
T |
 |
| Q |
107 |
caaatattcaaaaacaactccaacatagaaggaaaatctctccgg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439226 |
caaatattcaaaaacaactccaacatagaaggaaaatctctccgg |
9439270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University