View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_high_3 (Length: 472)
Name: NF0359_high_3
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 3e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 199 - 389
Target Start/End: Original strand, 24462989 - 24463177
Alignment:
| Q |
199 |
tgataagttctgaaaagatgaagaagaacccagagaatgagggggaaaaa-ggaagatctaaaacggtgatgaaagaaatattctgtcgagattcaggtg |
297 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24462989 |
tgataaggtctgaaaagatgaagaagaacccagagaatgaggggaaaaaaaggaagatctaaaacggtgatgaaagaaatattctgtcgagattcaggtg |
24463088 |
T |
 |
| Q |
298 |
atgtgatatagcaccaaatcggatagnnnnnnnnnnnnnnnngggtatgtgacttttgtttgttgggtcctccagacaagtaaggtcgaact |
389 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24463089 |
atgtgatatagcaccaaatcggatagaaaacaaaacaaaaaagggtatgtgacttttgtttgttggg---tccagacaagtaaggtagaact |
24463177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University