View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_low_12 (Length: 354)
Name: NF0359_low_12
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 41937615 - 41937866
Alignment:
| Q |
14 |
agaccactttatattgcaaaattcttgtgttattgatcactcattccctgacttatactttaatcaacgcgtatgttttggttctattgcagcaactgat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937615 |
agaccactttatattgcaaaattcttgtgttattgatcactcattgcctgacttatactttaatcaacgcgtatgttttggttctattgcagcaactgat |
41937714 |
T |
|
| Q |
114 |
aggtaaagtttagtgttggttgtgcttttgattctatttttaagtttgatagactgcttgtgagtatttgaatgacttagcattttagtccttgaagctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937715 |
aggtaaagtttagtgttggttgtgcttttgattctatttttaagtttggtagactgcttgtgagtatttgaatgacttagcattttagtccttgaagctg |
41937814 |
T |
|
| Q |
214 |
ttagggttggtcaatttagtccgtcaatatatatttttcctataattttgcg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41937815 |
ttagggttggtcaatttagtccgtcaatatatatttttcctataattatgcg |
41937866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 240
Target Start/End: Original strand, 11567571 - 11567619
Alignment:
| Q |
192 |
agcattttagtccttgaagctgttagggttggtcaatttagtccgtcaa |
240 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||| |||| |
|
|
| T |
11567571 |
agcattttagtccttgaaattgtaagggtcggtcaatttagtccctcaa |
11567619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1769 times since January 2019
Visitors: 3091