View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_low_15 (Length: 316)
Name: NF0359_low_15
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 73 - 233
Target Start/End: Original strand, 24463019 - 24463177
Alignment:
| Q |
73 |
cagagaatgagggggaaaaa-ggaagatctaaaacggtgatgaaagaaatattctgtcgagattcaggtgatgtgatatagcaccaaatcggatagnnnn |
171 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24463019 |
cagagaatgaggggaaaaaaaggaagatctaaaacggtgatgaaagaaatattctgtcgagattcaggtgatgtgatatagcaccaaatcggatagaaaa |
24463118 |
T |
|
| Q |
172 |
nnnnnnnnnnnngggtatgtgacttttgtttgttgggtcctccagacaagtaaggtcgaact |
233 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24463119 |
caaaacaaaaaagggtatgtgacttttgtttgttggg---tccagacaagtaaggtagaact |
24463177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University