View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_low_16 (Length: 311)
Name: NF0359_low_16
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0359_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 100 - 238
Target Start/End: Complemental strand, 25981681 - 25981543
Alignment:
Q |
100 |
caataatatgatagatgttttacaagatcaaaagtgggtgtctataccttggaaaaagttgcaggtcggagatattatcaaggtgagtgtgcagtatgct |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25981681 |
caataatatgatagatgttttacaagatcaaaagtgggtgtctataccttggaaaaagttgcaggtcggagatattatcaaggtgagtgtgcagtatgct |
25981582 |
T |
 |
Q |
200 |
atatgtttctgtgctatatttaattttgtcttgcctatg |
238 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25981581 |
atatgtttctgtgctatatttaattttgtcttgcctatg |
25981543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 83 - 188
Target Start/End: Complemental strand, 16248734 - 16248629
Alignment:
Q |
83 |
aatgagatggacatcatcaataatatgatagatgttttacaagatcaaaagtgggtgtctataccttggaaaaagttgcaggtcggagatattatcaagg |
182 |
Q |
|
|
||||| |||| ||| | |||||| ||||||||| |||| ||||| || |||||||||||||||| |||||||| ||||| || || || ||| | |||| |
|
|
T |
16248734 |
aatgacatggccataaacaataacatgatagatattttgcaagacaaagagtgggtgtctataccatggaaaaaattgcaagttggtgacattgttaagg |
16248635 |
T |
 |
Q |
183 |
tgagtg |
188 |
Q |
|
|
|||||| |
|
|
T |
16248634 |
tgagtg |
16248629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University