View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_low_19 (Length: 285)
Name: NF0359_low_19
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 44 - 241
Target Start/End: Complemental strand, 38925003 - 38924805
Alignment:
| Q |
44 |
acatcatcattacaatattggccacgggtttatcacaattctgccaaa-gtatacaatattgcaatatccctaaccatagaataaaatgacnnnnnnnng |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38925003 |
acatcatcattacaatattggccacgggtttatcacaattctgccaaaagtatacaatattgcaatatccctaaccatagaataaaatgacaaaaaaaag |
38924904 |
T |
|
| Q |
143 |
atagagtaagaaacaagtaaagaaccaaaaccaaaacctgtcaaatttacaccttgtcatcattctgactcagttccaattccacctcattaatctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38924903 |
atagagtaagaaacaagtaaagaaccaaaaccaaaacttgtcaaatttacaccttgtcatcattctgactcagttccaattccacctcattaatctgtg |
38924805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1687 times since January 2019
Visitors: 3091