View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_low_26 (Length: 259)
Name: NF0359_low_26
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359_low_26 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 30 - 259
Target Start/End: Original strand, 48777700 - 48777929
Alignment:
| Q |
30 |
atagcatctaagactactttgtagttgcaatttaataataattgcagaatgttgaattctcattaaacatgtctgtaaaaccagtttgcactaacggtgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48777700 |
atagcatctaagactactttgtagttgcaatttaataataattgcaaaatgttgaattctcattaaacatgtctgtaaaaccagtttgcactaacggtgt |
48777799 |
T |
 |
| Q |
130 |
atatcatatcatttcgattttcaggattaattccatttaatgttttaatcttgctacctagctagagagttgtattcattcatagctaagggaggcattg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48777800 |
atatcatatcatttcgattttcaggattaattccatttaatgttttaatcttgctacctagctagagagttgtattcattcatagctaagggaggcattg |
48777899 |
T |
 |
| Q |
230 |
gttttattatgtattatgtttgtaaatact |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48777900 |
gttttattatgtattatgtttgtaaatact |
48777929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University