View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_low_31 (Length: 218)
Name: NF0359_low_31
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0359_low_31 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 88 - 218
Target Start/End: Complemental strand, 543412 - 543282
Alignment:
Q |
88 |
aggggtagttattgcatatcataagtactcaatttgacggaaaagtaaacaaataacatcacgatcttaacagtaacaaatatttagacgacatctatat |
187 |
Q |
|
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
543412 |
aggggtagttattccatatcataagtactcaaattgacggaaaagtaaacaaataacatcacgatcttaacagtaacaaatatttagacgacatctatat |
543313 |
T |
 |
Q |
188 |
ctagatctataagccagttacataaatatat |
218 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
543312 |
ctagatctataagccagttacataaatatat |
543282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1564 times since January 2019
Visitors: 3090