View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359_low_32 (Length: 218)
Name: NF0359_low_32
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0359_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 52 - 194
Target Start/End: Complemental strand, 33338174 - 33338032
Alignment:
Q |
52 |
caaaggttcatcatccctaaccaaatataaacacttatataatgggataagaaacaggtaaagataagaagaaaaactagggttttttacattcaaattt |
151 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
33338174 |
caaaggttcatcatccctaaccaaatataaacacctacataatgggataagaaacaggtaaagataagaagaaaaactagggtttcttacattcaaattt |
33338075 |
T |
 |
Q |
152 |
cagtagtcccctacagttgcactatcattcaaggtgtttttgg |
194 |
Q |
|
|
|||||||||||||| ||||||||||| |||||||||||||||| |
|
|
T |
33338074 |
cagtagtcccctaccgttgcactatcgttcaaggtgtttttgg |
33338032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University