View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0360_high_2 (Length: 295)

Name: NF0360_high_2
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0360_high_2
NF0360_high_2
[»] chr3 (1 HSPs)
chr3 (48-225)||(34391965-34392144)
[»] chr5 (1 HSPs)
chr5 (98-216)||(41072769-41072887)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 48 - 225
Target Start/End: Complemental strand, 34392144 - 34391965
Alignment:
48 atgtcgaagaaaatggatcggtctagaaaggaagctgagtttgcactttctgccttaatggaaatacctgaccagtacaaggcaacactagaacttagta 147  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
34392144 atgtcgaagaacatggatcggtctagaaaggaagctgagtttgcactttccgccttaatggaaatacctgaccagtacaaggcaacactagaacttagta 34392045  T
148 tattggggtaacaatgttgaatcttttctttgtaggctttattgtatt--ggatttgaatatagcatctgcgcatgatga 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||    
34392044 tattggggtaacaatgttgaatcttttctttgtaggctttattgtattggggatttgaatatagcatctgcgcatgatga 34391965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 98 - 216
Target Start/End: Complemental strand, 41072887 - 41072769
Alignment:
98 tgccttaatggaaatacctgaccagtacaaggcaacactagaacttagtatattggggtaacaatgttgaatcttttctttgtaggctttattgtattgg 197  Q
    |||||| ||||||||||||  | |||||| |||||||||||||||| |||||||||||||||||| |||| |||||| || |||||||||  || |||||    
41072887 tgccttgatggaaataccttcctagtacatggcaacactagaacttggtatattggggtaacaatcttgactctttttttcgtaggcttttctgcattgg 41072788  T
198 atttgaatatagcatctgc 216  Q
    |||  ||||||||||||||    
41072787 attcaaatatagcatctgc 41072769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1255 times since January 2019
Visitors: 3079