View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0360_high_4 (Length: 271)

Name: NF0360_high_4
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0360_high_4
NF0360_high_4
[»] chr2 (2 HSPs)
chr2 (30-222)||(17219249-17219441)
chr2 (59-218)||(17221261-17221420)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 30 - 222
Target Start/End: Original strand, 17219249 - 17219441
Alignment:
30 gcataggtggtggaagagtcctgtcagaagttgatggggctggaacagccttatccggtggcgataacggtttggtgctttgactaggactaggtgatat 129  Q
    ||||||||||||||| | |||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
17219249 gcataggtggtggaaaactcctttcagcagttgatggggctggaacagccttatccggtggcgttaacggtttggtgctttgactaggactaggtgatat 17219348  T
130 ggatgattcacttcctttagtcttctgaggaggtggagctgatgtaggaggttgtaatgcaactggaggttgcaagaaagatcctggatgatg 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
17219349 ggatgattcacttcctttagtcttctgaggaggtggagctgatgtaggaggttgtaatgcgactggaggttgcaagaaagatcctggatgatg 17219441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 59 - 218
Target Start/End: Original strand, 17221261 - 17221420
Alignment:
59 gttgatggggctggaacagccttatccggtggcgataacggtttggtgctttgactaggactaggtgatatggatgattcacttcctttagtcttctgag 158  Q
    |||||||| |||||| |||  ||||  || ||||||| || |||||||||| |||||||||||||||||| || ||||||| |||||||| |||| ||||    
17221261 gttgatggtgctggagcagatttatatggcggcgatatcgatttggtgcttggactaggactaggtgatacggttgattcaattcctttaatcttttgag 17221360  T
159 gaggtggagctgatgtaggaggttgtaatgcaactggaggttgcaagaaagatcctggat 218  Q
    |||||||||||||||||| |||| |||||||||||||||||||||| | || ||||||||    
17221361 gaggtggagctgatgtagcaggtggtaatgcaactggaggttgcaatatagttcctggat 17221420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 613 times since January 2019
Visitors: 3063