View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_high_4 (Length: 271)
Name: NF0360_high_4
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 30 - 222
Target Start/End: Original strand, 17219249 - 17219441
Alignment:
| Q |
30 |
gcataggtggtggaagagtcctgtcagaagttgatggggctggaacagccttatccggtggcgataacggtttggtgctttgactaggactaggtgatat |
129 |
Q |
| |
|
||||||||||||||| | |||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17219249 |
gcataggtggtggaaaactcctttcagcagttgatggggctggaacagccttatccggtggcgttaacggtttggtgctttgactaggactaggtgatat |
17219348 |
T |
 |
| Q |
130 |
ggatgattcacttcctttagtcttctgaggaggtggagctgatgtaggaggttgtaatgcaactggaggttgcaagaaagatcctggatgatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17219349 |
ggatgattcacttcctttagtcttctgaggaggtggagctgatgtaggaggttgtaatgcgactggaggttgcaagaaagatcctggatgatg |
17219441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 59 - 218
Target Start/End: Original strand, 17221261 - 17221420
Alignment:
| Q |
59 |
gttgatggggctggaacagccttatccggtggcgataacggtttggtgctttgactaggactaggtgatatggatgattcacttcctttagtcttctgag |
158 |
Q |
| |
|
|||||||| |||||| ||| |||| || ||||||| || |||||||||| |||||||||||||||||| || ||||||| |||||||| |||| |||| |
|
|
| T |
17221261 |
gttgatggtgctggagcagatttatatggcggcgatatcgatttggtgcttggactaggactaggtgatacggttgattcaattcctttaatcttttgag |
17221360 |
T |
 |
| Q |
159 |
gaggtggagctgatgtaggaggttgtaatgcaactggaggttgcaagaaagatcctggat |
218 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||| | || |||||||| |
|
|
| T |
17221361 |
gaggtggagctgatgtagcaggtggtaatgcaactggaggttgcaatatagttcctggat |
17221420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University