View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_high_7 (Length: 206)
Name: NF0360_high_7
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0360_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 20 - 129
Target Start/End: Complemental strand, 40957994 - 40957885
Alignment:
Q |
20 |
acacgtatgcttaacagattctgcaggaacagcgtcttggtggaaactataatataactctctcgtctcatttgattgccaggtaccacctacttttttc |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
40957994 |
acacgtatgcttaacagattctgcaggaacagcgtcttggtggaaactataatataactctctcgtctcatttgattgccaggtaccacctccttttttc |
40957895 |
T |
 |
Q |
120 |
tctgcttcat |
129 |
Q |
|
|
|||||||||| |
|
|
T |
40957894 |
tctgcttcat |
40957885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 20 - 131
Target Start/End: Complemental strand, 40945001 - 40944890
Alignment:
Q |
20 |
acacgtatgcttaacagattctgcaggaacagcgtcttggtggaaactataatataactctctcgtctcatttgattgccaggtaccacctacttttttc |
119 |
Q |
|
|
|||| ||||| ||||||||||||||||||| | ||| |||||||||||||| | | |||||| || ||| ||||||||| |||||||| | ||||| |
|
|
T |
40945001 |
acacttatgcataacagattctgcaggaacctcatctcggtggaaactataaaacagctctctggtgtcaacggattgccagctaccacctccctttttt |
40944902 |
T |
 |
Q |
120 |
tctgcttcatct |
131 |
Q |
|
|
|||||||||||| |
|
|
T |
40944901 |
tctgcttcatct |
40944890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1129 times since January 2019
Visitors: 3076