View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_14 (Length: 328)
Name: NF0360_low_14
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 146 - 233
Target Start/End: Original strand, 409282 - 409369
Alignment:
| Q |
146 |
actccaacacttttggaaccatacccaacaacattaaactctctcatgctaactctcaacaacgttgttttgtggtcaacagtgtttt |
233 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
409282 |
actccaacacttttggaatcatacccaacaacattaaactctctcatgctaactctcaacaacgttgttttatggtcaacagtgtttt |
409369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1289 times since January 2019
Visitors: 3079