View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_15 (Length: 316)
Name: NF0360_low_15
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 91 - 241
Target Start/End: Complemental strand, 32782078 - 32781928
Alignment:
| Q |
91 |
caaaaatggtgggggtgaagctcagttgtggttagcctgcattgttggacctcttggtgtatggcttaggtggttcttagctaccagacttaatgagtgc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32782078 |
caaaaatggtgggggtgaagctcagttgtggttagcctgcattgttggacctcttggtgtatggcttaggtggttcttagctactagacttaatgagtgc |
32781979 |
T |
|
| Q |
191 |
gaaattggcggagggtttctgaaatggcttcgatttgggactcttattgcc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781978 |
gaaattggcggagggtttctgaaatggcttcgatttgggactcttattgcc |
32781928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1016 times since January 2019
Visitors: 3074