View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0360_low_15 (Length: 316)

Name: NF0360_low_15
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0360_low_15
NF0360_low_15
[»] chr3 (1 HSPs)
chr3 (91-241)||(32781928-32782078)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 91 - 241
Target Start/End: Complemental strand, 32782078 - 32781928
Alignment:
91 caaaaatggtgggggtgaagctcagttgtggttagcctgcattgttggacctcttggtgtatggcttaggtggttcttagctaccagacttaatgagtgc 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
32782078 caaaaatggtgggggtgaagctcagttgtggttagcctgcattgttggacctcttggtgtatggcttaggtggttcttagctactagacttaatgagtgc 32781979  T
191 gaaattggcggagggtttctgaaatggcttcgatttgggactcttattgcc 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
32781978 gaaattggcggagggtttctgaaatggcttcgatttgggactcttattgcc 32781928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University