View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_18 (Length: 310)
Name: NF0360_low_18
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 93 - 233
Target Start/End: Complemental strand, 35936872 - 35936732
Alignment:
| Q |
93 |
acatcatcaaaataaaccacacttcgaattcaaacatttagaaatgagaaaacagtatccatcaaacatttagaaatcagaaaacagtctccaacactga |
192 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35936872 |
acatcatcaaaatcaaccacacttcgaattcaaacatttagaaatgagaaaacagtatccatcaaacatttagaaatcagaacacagtctccaacactga |
35936773 |
T |
 |
| Q |
193 |
acattcaaccccactcacaaaaatcaagcattccagaataa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35936772 |
acattcaaccccactcacaaaaatcaagcattccagaataa |
35936732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 93 - 132
Target Start/End: Complemental strand, 35936993 - 35936954
Alignment:
| Q |
93 |
acatcatcaaaataaaccacacttcgaattcaaacattta |
132 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
35936993 |
acatcatcaaaatcaaccacacttcaaattcaaacattta |
35936954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University