View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_19 (Length: 305)
Name: NF0360_low_19
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 94 - 227
Target Start/End: Complemental strand, 47602300 - 47602167
Alignment:
| Q |
94 |
atatatgtgtgtgatatagataacatagtactttcattgctacacactacacaaagagacacaatttattcacttctttttcgtcacggttgaaatggga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47602300 |
atatatgtgtgtgatatagataacatagtactttcattgctacacactacacaaagagacacaatttattcacttctttttcgtcacggttgaaatggga |
47602201 |
T |
|
| Q |
194 |
tcacaacctcaatttgagcatccaaataaggcct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47602200 |
tcacaacctcaatttgagcatccaaataaggcct |
47602167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 227
Target Start/End: Original strand, 13384659 - 13384735
Alignment:
| Q |
150 |
agacacaatttattcacttctttttcgtcacggttgaaatgggatcacaacctcaatttgagcatccaaataaggcct |
227 |
Q |
| |
|
||||||| |||||||||||| |||| ||||| ||||||||| | ||||||| ||||||| |||||||| ||||||| |
|
|
| T |
13384659 |
agacacattttattcacttccttttggtcac-attgaaatggcaagacaacctgaatttgaacatccaaacaaggcct |
13384735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 13407800 - 13407844
Alignment:
| Q |
183 |
ttgaaatgggatcacaacctcaatttgagcatccaaataaggcct |
227 |
Q |
| |
|
||||||||| | |||||||| |||||||||||||||| ||||||| |
|
|
| T |
13407800 |
ttgaaatggcaacacaacctgaatttgagcatccaaagaaggcct |
13407844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 993 times since January 2019
Visitors: 3074