View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_24 (Length: 295)
Name: NF0360_low_24
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0360_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 48 - 225
Target Start/End: Complemental strand, 34392144 - 34391965
Alignment:
Q |
48 |
atgtcgaagaatatggatcggtctagaaaggaagctgagtttgcactttctgccttaatggaaatacctgaccagtacaaggcaacactagaacttagta |
147 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34392144 |
atgtcgaagaacatggatcggtctagaaaggaagctgagtttgcactttccgccttaatggaaatacctgaccagtacaaggcaacactagaacttagta |
34392045 |
T |
 |
Q |
148 |
tattggggtaacaatgttgaatcttttctttgtaggctttattgtatt--ggatttgaatatagcatctgcgcatgatga |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
34392044 |
tattggggtaacaatgttgaatcttttctttgtaggctttattgtattggggatttgaatatagcatctgcgcatgatga |
34391965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 98 - 216
Target Start/End: Complemental strand, 41072887 - 41072769
Alignment:
Q |
98 |
tgccttaatggaaatacctgaccagtacaaggcaacactagaacttagtatattggggtaacaatgttgaatcttttctttgtaggctttattgtattgg |
197 |
Q |
|
|
|||||| |||||||||||| | |||||| |||||||||||||||| |||||||||||||||||| |||| |||||| || ||||||||| || ||||| |
|
|
T |
41072887 |
tgccttgatggaaataccttcctagtacatggcaacactagaacttggtatattggggtaacaatcttgactctttttttcgtaggcttttctgcattgg |
41072788 |
T |
 |
Q |
198 |
atttgaatatagcatctgc |
216 |
Q |
|
|
||| |||||||||||||| |
|
|
T |
41072787 |
attcaaatatagcatctgc |
41072769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University