View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_26 (Length: 288)
Name: NF0360_low_26
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0360_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 80 - 190
Target Start/End: Complemental strand, 391850 - 391740
Alignment:
Q |
80 |
ttctttttcaacgcttaaggggttggagtttcttcctcgtttcaagtttggatttatatttacgtcttttatgctgcaacattgatttattaggctacaa |
179 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
391850 |
ttctttttcaacgcttaaggggttggagtttcttcctcgtttcaagtttggatttatatttacgtcttttatgctgcaacattgatttattaggctacaa |
391751 |
T |
 |
Q |
180 |
catctgttttt |
190 |
Q |
|
|
||||||||||| |
|
|
T |
391750 |
catctgttttt |
391740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University