View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0360_low_27 (Length: 287)

Name: NF0360_low_27
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0360_low_27
NF0360_low_27
[»] chr2 (1 HSPs)
chr2 (56-229)||(43512948-43513121)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 56 - 229
Target Start/End: Original strand, 43512948 - 43513121
Alignment:
56 gaaaggaaaatgcaatgaaagagtcttaaaatacacaaaagcatggtgggtcataccatcatgacctttttgcatgcgtctttcgttttaaatatttacc 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43512948 gaaaggaaaatgcaatgaaagagtcttaaaatacacaaaagcatggtgggtcataccatcatgacctttttgcatgcgtctttcgttttaaatatttacc 43513047  T
156 atatgtttttctttattcataggaaaaacacttattatatgttatttattaattaacagtagatggtgatgatg 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43513048 atatgtttttctttattcataggaaaaacacttattatatgttatttattaattaacagtagatggtgatgatg 43513121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1134 times since January 2019
Visitors: 3076