View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_27 (Length: 287)
Name: NF0360_low_27
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 56 - 229
Target Start/End: Original strand, 43512948 - 43513121
Alignment:
| Q |
56 |
gaaaggaaaatgcaatgaaagagtcttaaaatacacaaaagcatggtgggtcataccatcatgacctttttgcatgcgtctttcgttttaaatatttacc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43512948 |
gaaaggaaaatgcaatgaaagagtcttaaaatacacaaaagcatggtgggtcataccatcatgacctttttgcatgcgtctttcgttttaaatatttacc |
43513047 |
T |
 |
| Q |
156 |
atatgtttttctttattcataggaaaaacacttattatatgttatttattaattaacagtagatggtgatgatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513048 |
atatgtttttctttattcataggaaaaacacttattatatgttatttattaattaacagtagatggtgatgatg |
43513121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University