View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_30 (Length: 265)
Name: NF0360_low_30
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 12511583 - 12511342
Alignment:
| Q |
30 |
cttatcatatgatctggtcatactttatatcttccatgcaagctagctaaactgctaaaggcccccaaaataagtagttttcaattaattcagacgactg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12511583 |
cttatcatatgatctggtcatactttatatcttccatgcaagctagctaaactgctaaaggcccccaaaataagtagttttcaattaattcagacgactg |
12511484 |
T |
|
| Q |
130 |
aataaaacgtggagaaagaaaataaaacagtccatatatagtcacgcattctcaatatcttaacatttgcatt-------------tgaatacataacat |
216 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
12511483 |
aataacacgtggacaaagaaaataaaacagtccatatatagtcacgcattctcaatatcttaacatttgcattttctttcttttgatgaatacttaacat |
12511384 |
T |
|
| Q |
217 |
ttgcatatgttacagaaaatgtcatgtcttacattaaaaata |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12511383 |
ttgcatatgttacagaaaatgtcatgtcttacattaaaaata |
12511342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1847 times since January 2019
Visitors: 3091