View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_31 (Length: 265)
Name: NF0360_low_31
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 21 - 265
Target Start/End: Complemental strand, 34099162 - 34098916
Alignment:
| Q |
21 |
gtgagatgaacattccggcgaacgtttcttctttttccattaacaatgcacgtcttgccgatcatcgccgccacgtgttccacgagatgatactgtagtg |
120 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34099162 |
gtgaaatgaacattccggcgaacgtttcttctttttctattaacaatgcacgtcttgccgatcatcgccgccacgtgttccacgagatgatactgtagtg |
34099063 |
T |
 |
| Q |
121 |
tagtgtagttttacgaagattttcagaaactttttcttgca--nnnnnnnncatttctgttaaaatcatgtctccgatgaagatccgaccgatcgacatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34099062 |
tagtgtagttttacgaagattttcagaaactttttcttgcattttttttttcatttctgttgaaatcatgtctccgatgaagatccaaccgatcgacatc |
34098963 |
T |
 |
| Q |
219 |
gattcagagaagttagtggcggttcgatacgacgccgttaagcctgt |
265 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
34098962 |
gattcagagaagttagtggtggttcgaaacgacgccgttaagcctgt |
34098916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University