View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_34 (Length: 248)
Name: NF0360_low_34
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0360_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 889822 - 890038
Alignment:
Q |
1 |
ccctacgggaacattgtgtgaattaaactttctaactatccctttcttattacaattaggtatattcgtgaccaaccgtctaatttctaatgttaatgtg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
889822 |
ccctacgggaacattgtgtgaattaaactttctaactatccctttcttattacaattaggtatattcgtgaccaaccgtctaatttctaatgttaatgtg |
889921 |
T |
 |
Q |
101 |
cttaacgggaagactcttatcttccttcctactagagaaagagcttgaatcatttttaatgcttggaaacattctagagtattagatagttcaactgatt |
200 |
Q |
|
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||| |
|
|
T |
889922 |
cttaacgggaagactcatat----cttcctactagagaaagagcttgaatcatttttaatgcttgg-aacattctagagtattaggtagttcaattgatt |
890016 |
T |
 |
Q |
201 |
tgaactaagagataaagagttt |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
890017 |
tgaactaagagataaagagttt |
890038 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 11660579 - 11660543
Alignment:
Q |
185 |
gatagttcaactgatttgaactaagagataaagagtt |
221 |
Q |
|
|
||||||||||||||||||| ||||||| ||||||||| |
|
|
T |
11660579 |
gatagttcaactgatttgagctaagagttaaagagtt |
11660543 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University