View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_37 (Length: 218)
Name: NF0360_low_37
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0360_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 8677350 - 8677275
Alignment:
Q |
30 |
ttattttatctcatcttcggatgcaaatgatgtcttttttgtaaactttaattcagatgttcagtagttatcatct |
105 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
8677350 |
ttattttatctcattttcggatgcaaatgatgtcttttttgtaaactttaattaagacgttcagtagttatcatct |
8677275 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 36 - 105
Target Start/End: Complemental strand, 8643377 - 8643308
Alignment:
Q |
36 |
tatctcatcttcggatgcaaatgatgtcttttttgtaaactttaattcagatgttcagtagttatcatct |
105 |
Q |
|
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
8643377 |
tatctcattttaggatgcaaatgatgtcttttttgtaaactttaattcagatgttcagtaattatcatct |
8643308 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 36 - 105
Target Start/End: Complemental strand, 8635951 - 8635881
Alignment:
Q |
36 |
tatctcatcttcggatgcaaatgatgtctttttt-gtaaactttaattcagatgttcagtagttatcatct |
105 |
Q |
|
|
|||||||| || |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
T |
8635951 |
tatctcattttaggatgcaaatgatgtctttttttgtaaactttaattaagatgttcagtagttatcatct |
8635881 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 37 - 81
Target Start/End: Original strand, 8545365 - 8545409
Alignment:
Q |
37 |
atctcatcttcggatgcaaatgatgtcttttttgtaaactttaat |
81 |
Q |
|
|
||||||| || |||||||||||||||||||||||||||||||||| |
|
|
T |
8545365 |
atctcattttaggatgcaaatgatgtcttttttgtaaactttaat |
8545409 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 92
Target Start/End: Original strand, 1601349 - 1601392
Alignment:
Q |
48 |
ggatgcaaatgatgtcttttttgtaaactttaattcagatgttca |
92 |
Q |
|
|
|||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
1601349 |
ggatgcaaatgatgtc-tttttgtaaactttaatctagatgttca |
1601392 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University