View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0360_low_37 (Length: 218)

Name: NF0360_low_37
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0360_low_37
NF0360_low_37
[»] chr5 (5 HSPs)
chr5 (30-105)||(8677275-8677350)
chr5 (36-105)||(8643308-8643377)
chr5 (36-105)||(8635881-8635951)
chr5 (37-81)||(8545365-8545409)
chr5 (48-92)||(1601349-1601392)


Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 8677350 - 8677275
Alignment:
30 ttattttatctcatcttcggatgcaaatgatgtcttttttgtaaactttaattcagatgttcagtagttatcatct 105  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||    
8677350 ttattttatctcattttcggatgcaaatgatgtcttttttgtaaactttaattaagacgttcagtagttatcatct 8677275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 36 - 105
Target Start/End: Complemental strand, 8643377 - 8643308
Alignment:
36 tatctcatcttcggatgcaaatgatgtcttttttgtaaactttaattcagatgttcagtagttatcatct 105  Q
    |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
8643377 tatctcattttaggatgcaaatgatgtcttttttgtaaactttaattcagatgttcagtaattatcatct 8643308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 36 - 105
Target Start/End: Complemental strand, 8635951 - 8635881
Alignment:
36 tatctcatcttcggatgcaaatgatgtctttttt-gtaaactttaattcagatgttcagtagttatcatct 105  Q
    |||||||| || |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||    
8635951 tatctcattttaggatgcaaatgatgtctttttttgtaaactttaattaagatgttcagtagttatcatct 8635881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 37 - 81
Target Start/End: Original strand, 8545365 - 8545409
Alignment:
37 atctcatcttcggatgcaaatgatgtcttttttgtaaactttaat 81  Q
    ||||||| || ||||||||||||||||||||||||||||||||||    
8545365 atctcattttaggatgcaaatgatgtcttttttgtaaactttaat 8545409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 92
Target Start/End: Original strand, 1601349 - 1601392
Alignment:
48 ggatgcaaatgatgtcttttttgtaaactttaattcagatgttca 92  Q
    |||||||||||||||| |||||||||||||||||  |||||||||    
1601349 ggatgcaaatgatgtc-tttttgtaaactttaatctagatgttca 1601392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University