View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_4 (Length: 437)
Name: NF0360_low_4
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0360_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 76 - 408
Target Start/End: Complemental strand, 6716749 - 6716421
Alignment:
Q |
76 |
agggcggtagttttttgtgcttgtacttcaattgttgtttgtaatccttccatgattcaggcaacttcttgatcatgaggccagctacaaattcgttagg |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
T |
6716749 |
agggcggtagttttttgtgcttgtacttcaattgttgtttgtaatccttccatgattcaggcaacttcttgatcatgaggccagctacaaactcgtttgg |
6716650 |
T |
 |
Q |
176 |
gacatggaaattttcagcctttaattcctcaaggctcaagcaacttgtaatatccattgatttgatacttaatctctttgtcctctatcattgtaatgtc |
275 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
6716649 |
gacatggatattttcagcctttaattcctcaaggctcaagcaacttgtaatatccattgatttgatgcttaatctctttgtcctctatcattgtaatgtc |
6716550 |
T |
 |
Q |
276 |
cagcagaattagttgcctacgaagaagttattctttccagcatcttcaacaatgtatttcaaaacattgaatcccggtcatatttctttcacttccttgt |
375 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
T |
6716549 |
cagcagaagtagttgcctacgaagaagttattctttccagcatcttcaacaatgtatttcaaaacattgaatcc----catatttctttcgcttccttgt |
6716454 |
T |
 |
Q |
376 |
acaagcagtgcaaatcgaacagctagttagata |
408 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
6716453 |
acaagcagtgcaaatcgaacagctagttagata |
6716421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 386 times since January 2019
Visitors: 3060