View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0360_low_6 (Length: 433)
Name: NF0360_low_6
Description: NF0360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0360_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 73 - 388
Target Start/End: Complemental strand, 36502794 - 36502477
Alignment:
| Q |
73 |
atcataggatgctaggtttgcttcattgatgttgtttttgtgtggtgattggttggtgctaatagctgttttttgtctgcagctaaagaagaatgatatt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502794 |
atcataggatgctaggtttgcttcattgatgttgtttttgtgtggtgattggttggtgctaatagctgttttttgtctgcagctaaagaagaatgatatt |
36502695 |
T |
 |
| Q |
173 |
ttgagcaatacaattcagacaaggtcaaaggcacacaacatcatcaagcgaatgctggccagtttgggcgatccttatacacgttttctttcacctgagg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502694 |
ttgagcaatacaattcagacaaggtcaaaggcacacaacatcatcaagcgaatgctggccagtttgggcgatccttatacacgttttctttcacctgagg |
36502595 |
T |
 |
| Q |
273 |
aggtaatgcattcttcaattttcattagtgttgctctgtggagatttttctttttatcattagatgtttatgccttatgggc-acttgccttgcca-ccc |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
36502594 |
aggtaatgcattcttcaattttcattagtgttgctctgtggagatttttctttttatcattagatgtttatgccttatgggctttttgccttgccacccc |
36502495 |
T |
 |
| Q |
371 |
cctgatgtgagtcttgat |
388 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36502494 |
cctgatgtgagtcttgat |
36502477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University