View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_high_17 (Length: 213)
Name: NF0361_high_17
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 719543 - 719360
Alignment:
| Q |
1 |
gtaactataaatttagcttaagtctaaagagtttttgtcaagcactctctaaatgaaataatcaatttaggagtttcatgtcgnnnnnnngaattaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
719543 |
gtaactataaatttagcttaagtctaaagagtttttgtcaagcactctctaaatgaaataatcaatttaggagtttcatgtcgaaaaaaagaattaagaa |
719444 |
T |
|
| Q |
101 |
cataaataattcactgatataacgaaacaaagaatatatataatcagctagaatcatacttaagtacacataaacccaacaaaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
719443 |
cataaataattcactgatataacgaaacaaagaatatatataatcagctagaatcatacttaagtacacataatcccaacaaaa |
719360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1753 times since January 2019
Visitors: 3091