View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_17 (Length: 318)
Name: NF0361_low_17
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_low_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 162 - 318
Target Start/End: Original strand, 31338112 - 31338268
Alignment:
| Q |
162 |
gatcatactaaccgagtccaatggcttcctttcctttcatgatacgtagacgcttgcatgaatcaataaacatcctgtcgacacaaagaaaataaaaatg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31338112 |
gatcatactaaccgagtccaatggcttcctttcctttcatgatacgtagacgcttgcatgaatcaataaacatcctgtcgacacagagaaaataaaaatg |
31338211 |
T |
 |
| Q |
262 |
ttttcgttagctatatattgtggttgtggtttctctgtctcatcatggatcgatatt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31338212 |
ttttcgttagctatatattgtggttgtggtttctctgtctcatcatggatcgatatt |
31338268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 238
Target Start/End: Complemental strand, 38532460 - 38532388
Alignment:
| Q |
166 |
atactaaccgagtccaatggcttcctttcctttcatgatacgtagacgcttgcatgaatcaataaacatcctg |
238 |
Q |
| |
|
||||||||| | ||||| || |||||||||||||||||||| | ||| |||||||| |||| |||||||||| |
|
|
| T |
38532460 |
atactaacctataccaatagcctcctttcctttcatgatacgcaaacgtttgcatgattcaacaaacatcctg |
38532388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University