View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_18 (Length: 307)
Name: NF0361_low_18
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 82 - 229
Target Start/End: Original strand, 31440494 - 31440640
Alignment:
| Q |
82 |
ttgtcacaattcttaagtaatttggttgacttggatttaggttctttgaaaagaatgcaacttttaaatgtttcagaacatatagtttgtgttggttgaa |
181 |
Q |
| |
|
||||||||| | ||||||||| |||||||||| |||||||||| ||| ||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31440494 |
ttgtcacaagttttaagtaatctggttgacttagatttaggttatttaaaaagaacgcaacatttaaatgtttcagaatatatagtttgtgttggttgaa |
31440593 |
T |
 |
| Q |
182 |
ggctcatagacctaatgttttatatgattatcatgtttggtggagtaa |
229 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31440594 |
ggct-gtatacctaatgttttatatgattatcatgtttggtggagtaa |
31440640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 229
Target Start/End: Original strand, 33609049 - 33609107
Alignment:
| Q |
171 |
tgttggttgaaggctcatagacctaatgttttatatgattatcatgtttggtggagtaa |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||| ||||| || ||||||||| |
|
|
| T |
33609049 |
tgttggttgaaggctcataagcctaatgttttttatgattttcatgctttgtggagtaa |
33609107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University