View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_22 (Length: 286)
Name: NF0361_low_22
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 65 - 239
Target Start/End: Complemental strand, 36139533 - 36139359
Alignment:
| Q |
65 |
tagcttttcttgatccactaaatctacctgaattctgcatccaatttgtctttgtaagaatttcagaatagtgaagaatgtattcccaaacaaatattga |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36139533 |
tagcttttcttgatccactaaatctacctgaattctgcatccaatttgtctttgtaagaatttcagaatagtgaagaatgtattcccaaacaaatattga |
36139434 |
T |
 |
| Q |
165 |
atgacatactgctcaagatgcttggaaatagcaaattgcaactcatctagtcttttcttgtaacttttccccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36139433 |
atgacatactgctcaagatgcttggaaatagcaaattgcaactcatctagtcttttcttgtaacttttccccttt |
36139359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 65 - 239
Target Start/End: Complemental strand, 30820229 - 30820056
Alignment:
| Q |
65 |
tagcttttcttgatccactaaatctacctgaattctgcatccaatttgtctttgtaagaatttcagaatagtgaagaatgtattcccaaacaaatattga |
164 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||| ||||| ||||| | |
|
|
| T |
30820229 |
tagcttttcattatccactaaatctacctgaattctgcatccaatttatctta-taagaatttcagaatagtggtgaatgtattccaaaacagatattaa |
30820131 |
T |
 |
| Q |
165 |
atgacatactgctcaagatgcttggaaatagcaaattgcaactcatctagtcttttcttgtaacttttccccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
30820130 |
atgacatactgctcaagatgcttggaaatagcagtttgcaactcatctagtcttttcctgtaacctttccccttt |
30820056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University