View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_23 (Length: 285)
Name: NF0361_low_23
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 80 - 246
Target Start/End: Complemental strand, 10945828 - 10945662
Alignment:
| Q |
80 |
agactaacccacagcagaagaaatgtcactatccaaaatttgagctttcttacgctgtttgaagaaaaaagctgcaacccacaatggatttttacttgaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10945828 |
agactaacccacagcagaagaaatgtcactatccaaaatttgagctttcttaagttgtttgaagaaaaaagctgcaacccacaatggatttttacttgaa |
10945729 |
T |
|
| Q |
180 |
cataaccctttcttagatttcaacattttcttcttcttcttcacaaagtactatgttcttttctgtc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10945728 |
cataaccctttcttagatttcaacattttcttcttcttcttcacaaagtactatgttgttttctgtc |
10945662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 984 times since January 2019
Visitors: 3074