View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_24 (Length: 253)
Name: NF0361_low_24
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 34942126 - 34941896
Alignment:
| Q |
1 |
ccactcaaataaccgaatagttgacagcatcggttcacggtttaaccggttgaactgtatggttcggttccaccatttctgaattctagacctaatagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34942126 |
ccactcaaataaccgaatagttgacagcatcggttcacggtttaaccggttgaactgtatggttcggttccaccatttctgaattctagacctaatagat |
34942027 |
T |
|
| Q |
101 |
cattacttgaacttcacttttatgtttatgtcataaggatacaatatgctacatggaaagaagaatgtcgccaattgtttcctcttgttggaagtggtcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34942026 |
cattacttgaacttcacttttatgtttatgtcataaggatacaatatgctacatggaaaaaagaatgtcgccaattgtttcctcttgttggaagtggtcg |
34941927 |
T |
|
| Q |
201 |
atttatcacatctcctgtaattactgatgat |
231 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |
|
|
| T |
34941926 |
atttatcacatcccctgtaattactgatgat |
34941896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 142 - 209
Target Start/End: Original strand, 31398521 - 31398588
Alignment:
| Q |
142 |
caatatgctacatggaaagaagaatgtcgccaattgtttcctcttgttggaagtggtcgatttatcac |
209 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
31398521 |
caatatgctgaatggaaggaagaatgtcgccaactgtttcctcttgtaggaagtggtagatttatcac |
31398588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 930 times since January 2019
Visitors: 3072