View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_25 (Length: 251)
Name: NF0361_low_25
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 27 - 224
Target Start/End: Original strand, 27832388 - 27832585
Alignment:
| Q |
27 |
atggaaaaaacttacatcaattgagaaatatctttgaaataattccatcaaattaaagtaggtatatttaattatatttgaagtttttcttactgatatt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27832388 |
atggaaaaaacttacatcaattgagaaatatctttgaaataattccatcaaattaaagtaggtatatttaattatatttgaagtttttcttactgatatt |
27832487 |
T |
|
| Q |
127 |
ttagatcaaaggattaggaagcaagtgctaaatgagataaaggaaattaggtttcaaataacaaagctcttgcgcagcaaaatgtgaataagatattg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27832488 |
ttagatcaaaggattaggaagcaagtgctaaatgagataaaggaaattaggtttcaaataacaaagctcttgcgcagcaaaatgtgaataagatattg |
27832585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1030 times since January 2019
Visitors: 3074