View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_28 (Length: 229)
Name: NF0361_low_28
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0361_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 22234679 - 22234824
Alignment:
| Q |
1 |
caatttgcttctttttctccttttaagcaattggagataccaaactatgatcttcagcctcagatcttttgcagggttgtcaatgtccaactacttgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22234679 |
caatttgcttctttttctccttttaagcaattggagataccaaactatgatcttcagcctcagatcttttgcagggttgtcaatgtccaactacttgtaa |
22234778 |
T |
 |
| Q |
101 |
gtactcaattatactctttgaattaactattagtgtttacctatga |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22234779 |
gtactcaattatactctttgaattaactattagtgtttacctatga |
22234824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University