View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0361_low_30 (Length: 213)
Name: NF0361_low_30
Description: NF0361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0361_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 124 - 203
Target Start/End: Original strand, 719601 - 719680
Alignment:
Q |
124 |
ctttagtttgtaaagtttcactacatttagcgtgtcttagtttatgaatatctgaacacaaacgctctccttcctctctg |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
719601 |
ctttagtttgtaaagtttcactacatttagcgtgtcttagtttatgaatatctgaacacaaacgctctccttcctctctg |
719680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 719519 - 719599
Alignment:
Q |
1 |
agacttaagctaaatttatagttacataattctatcatacaaatcaactaaccctggcaatatataatcgaccaagaggat |
81 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
T |
719519 |
agacttaagctaaatttatagttacataattctatcatacaaatcaactaaccttgacaatatataatcgaccaagaggat |
719599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1877 times since January 2019
Visitors: 3094