View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0362_high_3 (Length: 262)
Name: NF0362_high_3
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0362_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 95 - 251
Target Start/End: Complemental strand, 24363510 - 24363354
Alignment:
| Q |
95 |
cctattgtgagtgctgcagtagaggatccaggaccctcaaatttacattgtgatatatttcaaataagtgtaaaacactcatactactaatttgcttatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24363510 |
cctattgtgagtgctgcagtagaggatccaggaccctcaaatttacattgtgatatattttaaataagtgtaaaacactcatagtactaatttgcttatt |
24363411 |
T |
|
| Q |
195 |
cattaattatacttgtctaactatcacatttttccatgttgattttgttgctcattt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24363410 |
cattaattatacttgtctaactatcacatttttccatgttgattttgttgctcattt |
24363354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 767 times since January 2019
Visitors: 3065