View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0362_high_6 (Length: 214)
Name: NF0362_high_6
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0362_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 43862002 - 43861886
Alignment:
| Q |
1 |
actaatcataatcaacatcatcttcataaatttgatacgttagtaataattaatgataataattaagcaaagtactaatgattaattcaagagatgaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43862002 |
actaatcataatcaacatcatcttcataaatttgatacgttagtagtaattaatgataataattaagcaaagtactaatgattaattcaagagatgaatg |
43861903 |
T |
 |
| Q |
101 |
agccaaaccttgtttgt |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43861902 |
agccaaaccttgtttgt |
43861886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University