View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0362_high_7 (Length: 209)
Name: NF0362_high_7
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0362_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 42 - 125
Target Start/End: Original strand, 37259690 - 37259778
Alignment:
Q |
42 |
cgtcccacgtaaataaaatatgaaaggccttgtgtgtg-----ttaataaagggtttgacgacaatataaaatttcaattgcattccag |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37259690 |
cgtcccacgtaaataaaatatgaaaggccttgtgtgtgttgtgttaataaagggtttgacgacaatataaaatttcaattgcattccag |
37259778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1241 times since January 2019
Visitors: 3078