View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0362_low_1 (Length: 321)
Name: NF0362_low_1
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0362_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 7 - 291
Target Start/End: Complemental strand, 24363340 - 24363056
Alignment:
| Q |
7 |
gtatcatagggccactacctttagatagttcgttactttggtggttgcactttcttaatttattgatagttttgtattggaaagttgttgttggtaggac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24363340 |
gtatcatagggccactacctttagatagttcgttactttggtggttgcactttcttaatttattgatagttttgtattggaaagttgttgttggtaggac |
24363241 |
T |
 |
| Q |
107 |
ccctcttatctaactaaagtcatgcttgcttacttatgaggtaatcaacttgaataagaatagagctaaactttggcaagataacatgcagtatagagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24363240 |
ccctcttatctaactaaagtcatgcttgcttacttatgaggtaatcaacttgaataagaatagagctaaactttggcaagataacatgcagtatagagaa |
24363141 |
T |
 |
| Q |
207 |
agcatacaaaagctgaagccttatgtgtttggaagttttataacaaattttagcttatggctagtaatattcaaagatgtagtac |
291 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24363140 |
agcatagaaaagctgaagccttatgtgtttggaagttttataacaaattttagcttatggctagtaatattcaaagatgtagtac |
24363056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University