View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0362_low_3 (Length: 298)

Name: NF0362_low_3
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0362_low_3
NF0362_low_3
[»] chr7 (1 HSPs)
chr7 (74-286)||(43634194-43634406)


Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 74 - 286
Target Start/End: Complemental strand, 43634406 - 43634194
Alignment:
74 acaacaaccaacacccccgcaagcaagaagaattaaaaacacatgcaacttcaacattgggcatgatagaaggcgtnnnnnnntaacttatctgacgata 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||| |||    
43634406 acaacaaccaacacccccgcaagcaagaagaattaaaaacacatgcaacttcaacattgggcatgatagaaggcgtaaaaaaataacttatctgacaata 43634307  T
174 aattaatggataatcgaaatcggacggcttagctctgagtcactaccaaaatggaattttgacctttgattgcgctccttcaacaacaaccatatactca 273  Q
    ||||| ||||||||||||||||||||| ||| || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43634306 aattagtggataatcgaaatcggacggtttatctatgagtcactgccaaaatggaattttgacctttgattgcgctccttcaacaacaaccatatactca 43634207  T
274 caaaccaaatatt 286  Q
    |||||||||||||    
43634206 caaaccaaatatt 43634194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University