View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0362_low_3 (Length: 298)
Name: NF0362_low_3
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0362_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 74 - 286
Target Start/End: Complemental strand, 43634406 - 43634194
Alignment:
Q |
74 |
acaacaaccaacacccccgcaagcaagaagaattaaaaacacatgcaacttcaacattgggcatgatagaaggcgtnnnnnnntaacttatctgacgata |
173 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
T |
43634406 |
acaacaaccaacacccccgcaagcaagaagaattaaaaacacatgcaacttcaacattgggcatgatagaaggcgtaaaaaaataacttatctgacaata |
43634307 |
T |
 |
Q |
174 |
aattaatggataatcgaaatcggacggcttagctctgagtcactaccaaaatggaattttgacctttgattgcgctccttcaacaacaaccatatactca |
273 |
Q |
|
|
||||| ||||||||||||||||||||| ||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43634306 |
aattagtggataatcgaaatcggacggtttatctatgagtcactgccaaaatggaattttgacctttgattgcgctccttcaacaacaaccatatactca |
43634207 |
T |
 |
Q |
274 |
caaaccaaatatt |
286 |
Q |
|
|
||||||||||||| |
|
|
T |
43634206 |
caaaccaaatatt |
43634194 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University