View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0362_low_4 (Length: 294)
Name: NF0362_low_4
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0362_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 46 - 243
Target Start/End: Complemental strand, 45595473 - 45595276
Alignment:
| Q |
46 |
tcttgactatattgtatctgttgaaagtgatgtatttgtacattcttaccctggcaacatggcgcgagcggttgaaggccatcgtcgttttcttgggaga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45595473 |
tcttgactatattgtatctgttgaaagtgatgtatttgtacattcttaccctggcaacatggcgcgagcggttgaaggccatcgtcgttttcttgggaga |
45595374 |
T |
 |
| Q |
146 |
ggaagaaccatttctccagataggtgagcctctctttctctcctaagcagatgaattaattttgtaattcattatccctaatgtttgcctttgtttct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45595373 |
ggaagaaccatttctccagataggtgagcctctctttctctcctaagcagatgaattaattttgtaattcattatccctaatgtttgcctttgcttct |
45595276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 46 - 141
Target Start/End: Complemental strand, 27149046 - 27148951
Alignment:
| Q |
46 |
tcttgactatattgtatctgttgaaagtgatgtatttgtacattcttaccctggcaacatggcgcgagcggttgaaggccatcgtcgttttcttgg |
141 |
Q |
| |
|
||||||||||||||||||| | || |||||||||||| ||| ||||| |||| |||||||| | || |||||||| ||||| ||||||||||| |
|
|
| T |
27149046 |
tcttgactatattgtatctatcgagagtgatgtatttataccctcttattctggaaacatggcaagggctgttgaaggtcatcgccgttttcttgg |
27148951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University