View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0362_low_7 (Length: 226)
Name: NF0362_low_7
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0362_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 43862319 - 43862533
Alignment:
Q |
1 |
tttaatccacatgcagctgcttacaagattttaatttgtttggcatgttagattagttatctatgataacaaaattttatggaattataactttgtttaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43862319 |
tttaatccacatgcagctgcttacaagattttaatttgtttggcatgttagattagttatctatgataacaaaattttatggaattataactttgtttaa |
43862418 |
T |
 |
Q |
101 |
ctttttcatggtcttcgagaaattttagnnnnnnnnnnnaatatttttaaatataataaaaaatagctggacttgcgtgtgatgaaattctatgaaaatt |
200 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43862419 |
ctttttcatggtcttcgagaaattttag-ttttttttttaatatttttaaatataataaaaaatagctggacttgcgtgtgatgaaattctatgaaaatt |
43862517 |
T |
 |
Q |
201 |
gtccgtctttgtatat |
216 |
Q |
|
|
|||||||||||||||| |
|
|
T |
43862518 |
gtccgtctttgtatat |
43862533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 865 times since January 2019
Visitors: 3069