View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0362_low_9 (Length: 214)

Name: NF0362_low_9
Description: NF0362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0362_low_9
NF0362_low_9
[»] chr8 (1 HSPs)
chr8 (1-117)||(43861886-43862002)


Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 43862002 - 43861886
Alignment:
1 actaatcataatcaacatcatcttcataaatttgatacgttagtaataattaatgataataattaagcaaagtactaatgattaattcaagagatgaatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43862002 actaatcataatcaacatcatcttcataaatttgatacgttagtagtaattaatgataataattaagcaaagtactaatgattaattcaagagatgaatg 43861903  T
101 agccaaaccttgtttgt 117  Q
    |||||||||||||||||    
43861902 agccaaaccttgtttgt 43861886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University