View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0363_low_4 (Length: 267)
Name: NF0363_low_4
Description: NF0363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0363_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 118 - 255
Target Start/End: Original strand, 39321685 - 39321822
Alignment:
| Q |
118 |
tcatggacttcttaacatgacatcttgaaaaagacaaacatttatcattgaaatagctagttagcgcaccattcagatattctgttcaaaatgttacatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
39321685 |
tcatggacttcttaacatgacatcttgaaaaagacaaacatttatcattgaaatagctagttagcgcaccattcagatagtctgttcaaaaagttacatt |
39321784 |
T |
 |
| Q |
218 |
ggttgtcttccttcttctcaacatttttgttatccctt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39321785 |
ggttgtcttccttcttctcaacatttttgttatccctt |
39321822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 117
Target Start/End: Original strand, 39321624 - 39321654
Alignment:
| Q |
87 |
tatagtattatctacattgacctcttctttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39321624 |
tatagtattatctacattgacctcttctttg |
39321654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University