View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0363_low_5 (Length: 246)
Name: NF0363_low_5
Description: NF0363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0363_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 4 - 214
Target Start/End: Original strand, 39322174 - 39322389
Alignment:
| Q |
4 |
ctttcaaaattatattctgaagggtgnnnnnnnnccttctatttgtttacggcttgaatgtagcattagttgttggtggcaacgatgacttgtttcaatt |
103 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39322174 |
ctttcaaaattatattctgaaaggtgttttttt-ccttctatttgtttactgcttgaatgtagcattagttgttggtggcaacgatgacttgtttcaatt |
39322272 |
T |
|
| Q |
104 |
gtaaaataaacttaa------aatatgcactagctaggttgataatttagttgagtttaataatagttgataaacaatttccccttcaagaatttcaaag |
197 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39322273 |
gtataataaacttaaaattaaaatatgcactagctaggttgataatttagttgagtttaataatagttgataaacaatttccccttcaagaatttcaaag |
39322372 |
T |
|
| Q |
198 |
tagcgtattatattaat |
214 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39322373 |
tagcgtattatattaat |
39322389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 380 times since January 2019
Visitors: 3059