View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0364_high_2 (Length: 302)
Name: NF0364_high_2
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0364_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 129 - 166
Target Start/End: Original strand, 22482221 - 22482258
Alignment:
Q |
129 |
aattttcgaaggtgtgcattagcatcctacacctattt |
166 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
T |
22482221 |
aattttagaaggtgtgcattagcatcctacacctattt |
22482258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 166
Target Start/End: Complemental strand, 22482918 - 22482881
Alignment:
Q |
129 |
aattttcgaaggtgtgcattagcatcctacacctattt |
166 |
Q |
|
|
|||||| ||||||||||||||||||||||| ||||||| |
|
|
T |
22482918 |
aattttagaaggtgtgcattagcatcctactcctattt |
22482881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 163
Target Start/End: Complemental strand, 15285701 - 15285665
Alignment:
Q |
127 |
tcaattttcgaaggtgtgcattagcatcctacaccta |
163 |
Q |
|
|
|||||||| ||| |||||||||||||||||||||||| |
|
|
T |
15285701 |
tcaattttagaatgtgtgcattagcatcctacaccta |
15285665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 166
Target Start/End: Original strand, 46753292 - 46753321
Alignment:
Q |
137 |
aaggtgtgcattagcatcctacacctattt |
166 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
46753292 |
aaggtgtgcattagcatcctacacctattt |
46753321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 163
Target Start/End: Original strand, 22242928 - 22242964
Alignment:
Q |
127 |
tcaattttcgaaggtgtgcattagcatcctacaccta |
163 |
Q |
|
|
|||||||| |||| ||||||||||||||||||||||| |
|
|
T |
22242928 |
tcaattttagaagatgtgcattagcatcctacaccta |
22242964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 163
Target Start/End: Complemental strand, 22243161 - 22243125
Alignment:
Q |
127 |
tcaattttcgaaggtgtgcattagcatcctacaccta |
163 |
Q |
|
|
|||||||| ||||||||||||||||||| |||||||| |
|
|
T |
22243161 |
tcaattttagaaggtgtgcattagcatcatacaccta |
22243125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 164
Target Start/End: Original strand, 23729491 - 23729524
Alignment:
Q |
131 |
ttttcgaaggtgtgcattagcatcctacacctat |
164 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |
|
|
T |
23729491 |
ttttagaaggtgtgcattagcatcctacacctat |
23729524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University