View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0364_high_8 (Length: 246)

Name: NF0364_high_8
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0364_high_8
NF0364_high_8
[»] chr5 (1 HSPs)
chr5 (1-166)||(19618690-19618853)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 19618853 - 19618690
Alignment:
1 tttccacaattgattgttgttttaacaaaataaataaatacatccgcaccttaaaaattggtgtgttgtagtaattatccnnnnnnnnnnnnngtagtaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||             |||||||    
19618853 tttccacaattgattgttgttttaacaaaataaataaatacatccgcaccttataaattggtgtgttgtagtaattatcc--tttttttttttgtagtaa 19618756  T
101 ttatccatgtgacttttacttttcatatgatggaaatgaatgtgatattggatgaagtgatgatgt 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19618755 ttatccatgtgacttttacttttcatatgatggaaatgaatgtgatattggatgaagtgatgatgt 19618690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University