View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0364_low_10 (Length: 305)
Name: NF0364_low_10
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0364_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 90 - 278
Target Start/End: Original strand, 34451899 - 34452087
Alignment:
Q |
90 |
acaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
189 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34451899 |
acaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
34451998 |
T |
 |
Q |
190 |
atatgatgggaacagtccnnnnnnngcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaa |
278 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
34451999 |
atatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaa |
34452087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1060 times since January 2019
Visitors: 3075