View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0364_low_15 (Length: 256)
Name: NF0364_low_15
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0364_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 29 - 255
Target Start/End: Original strand, 8087799 - 8088027
Alignment:
Q |
29 |
agaaagtatatagatggtgtatgcttacttttttcctttggaagtggtataataatgttgcattaagaatgaaattctgaggtaatcagaaacaatcttg |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8087799 |
agaaagtatatagatggtgtatgcttacttttttcctttggaagtggtataataatgttgcattaagaatgaaattctgaggtaatcagaaacaatcttg |
8087898 |
T |
 |
Q |
129 |
taatggataaatggttgctttaaaatttaatgattttgtctctataactctattctgatacaccaaaaagtctt--aatatttgaaaatcgaaactaagg |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
T |
8087899 |
taatggataaatggttgctttaaaatttaatgattttgtctctataactctattctgatacaccaaaaagtcttacaatatttgagaatcgaaactaagg |
8087998 |
T |
 |
Q |
227 |
acgattaacaaacacgtactctcctcaac |
255 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
8087999 |
acgattaacaaacacgtactctcctcaac |
8088027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1170 times since January 2019
Visitors: 3076