View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0364_low_17 (Length: 250)
Name: NF0364_low_17
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0364_low_17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 56 - 250
Target Start/End: Complemental strand, 38931807 - 38931613
Alignment:
| Q |
56 |
ttcataaataatgtgctctttctattccattcatttcccgggtttcttaaaagttattagaatgaaaagttacatatgtatccctaatgcagtataaggt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931807 |
ttcataaataatgtgctctttctattccattcgattcccgggtttcttaaaagttattagaatgaaaagttacatatgtatccctaatgcagtataaggt |
38931708 |
T |
 |
| Q |
156 |
ttataattcagttaagaacttcaacaaataaaagttcagtataaggtttagaatagcacctcaataacatcactggtagaaagtgcagcttttac |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38931707 |
ttaaaattcagttaagaacttcaacaaataaaagttcagtataaggtttagaatagcacctgaataacatcactggtagaaagtgcagcttttac |
38931613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University